Variant: NM_001754.5(RUNX1):c.166_196del (p.Leu56fs)

CA913189256

978818 (ClinVar)

Gene: RUNX1

Condition: hereditary thrombocytopenia and hematological cancer predisposition syndrome associated with RUNX1

Inheritance Mode: Autosomal dominant inheritance

UUID: e04d2c7a-112a-4963-afd5-2ef16d750b0a

Approved on: 2023-12-09

Published on: 2023-12-09

HGVS expressions

NM_001754.5:c.166_196del
NM_001754.5:c.166_196delTTGCCGCTGGGCGCCCCGGACGCCGGCGCTG
NM_001754.5(RUNX1):c.166_196del (p.Leu56fs)
NC_000021.9:g.34886999_34887029del
CM000683.2:g.34886999_34887029del
NC_000021.8:g.36259296_36259326del
CM000683.1:g.36259296_36259326del
NC_000021.7:g.35181166_35181196del
NG_011402.2:g.1102684_1102714del
ENST00000675419.1:c.166_196del
ENST00000300305.7:c.166_196del
ENST00000344691.8:c.85_115del
ENST00000358356.9:c.85_115del
ENST00000399237.6:c.130_160del
ENST00000399240.5:c.85_115del
ENST00000437180.5:c.166_196del
ENST00000455571.5:c.127_157del
ENST00000482318.5:c.59-6315_59-6285del
NM_001001890.2:c.85_115del
NM_001122607.1:c.85_115del
NM_001754.4:c.166_196del
NM_001001890.3:c.85_115del
NM_001122607.2:c.85_115del

Pathogenic

• Met criteria codes: PVS1 PS4_Moderate PM5_Supporting PM2_Supporting

• Not Met criteria codes: PS2 PS3 PS1 PP4 PP1 PP3 PP2 PM3 PM1 PM4 PM6 BA1 BS4 BS3 BS1 BS2 BP5 BP7 BP2 BP3 BP4 BP1

Expert Panel

Myeloid Malignancy VCEP

Criteria Specification Information

Criteria Specification: ClinGen Myeloid Malignancy Expert Panel Specifications to the ACMG/AMP Variant Interpretation Guidelines Version 2

Evidence submitted by expert panel

Myeloid Malignancy VCEP

The NM_001754.5(RUNX1):c.166_196del (p.Leu56ProfsTer6) variant in RUNX1 is a frameshift variant predicted to cause a premature stop codon in biologically relevant exon 4/9 leading to nonsense mediated decay in a gene in which loss-of-function is an established disease mechanism (PVS1). This variant is absent from gnomAD v2, v3, and v4 with at least 20x coverage (PM2_Supporting). It has been reported in a proband with thrombocytopenia and MDS/MPN-U and her "affected" sister (PMID: 37216690), as well as in 2 additional probands meeting phenotypic criteria for RUNX1 (PMID: 37406166) (PS4_Moderate, PP1 is not met). It has also been reported in a patient with MDS, but variant origin is unclear (cBioPortal.org - Papaemmanuil Lab, 2022). Furthermore, other pathogenic/likely pathogenic frameshift alterations in exon 4 have been reported (PMID: 35764482) (PM5_Supporting). In summary, this variant meets the criteria to be classified as pathogenic for autosomal dominant hereditary thrombocytopenia and hematologic cancer predisposition syndrome based on the ACMG/AMP criteria applied, as specified by the ClinGen Myeloid Malignancy VCEP: PVS1, PS4_Moderate, PM2_Supporting, and PM5_Supporting. (Version 2; date of approval)

Met criteria codes

• PVS1: Frameshift deletion resulting in a premature stop codon in exon 4, which is expected to result in a product subject to nonsense-mediated decay.
• PS4_Moderate: The germline variant has been reported in 52yo female with low platelet count and MDS/MPN-U (PMID: 37216690); a 57yo male with thrombocytopenia, mild leukopenia, and CMML (PMID: 37406166); and a 52yo female with thrombocytopenia and acute leukemia (PMID: 37406166). The variant was also identified in 1/3323 treatment-naïve MDS patients from the International Working Group for the prognosis of Myelodysplastic Syndromes (cBioPortal.org - Papaemmanuil Lab, 2022); however, germline origin could not be confirmed in this individual.
• PM5_Supporting: Other pathogenic or likely pathogenic frameshift alterations in exon 4 (coding exon 3) have been reported (Feurstein et al., 2022, 35764482 - Supplementary Table 5).
• PM2_Supporting: Completely absent from gnomAD with a mean coverage of at least 20X (v2+v3+v4).

Not Met criteria codes

• PS2: No relevant cases found in literature search, including LOVD, HGMD, ClinVar, COSMIC, Mastermind, and Google/Google Scholar searches.
• PS3: No relevant literature was found in LOVD, HGMD, ClinVar, COSMIC, Mastermind, and Google/Google Scholar searches.
• PS1: No code specific comments provided, please refer to the summary above or general recommendations provided in the guideline
• PP4: Not applicable
• PP1: The affected sibling of the 52yo female with low platelet count and MDS/MPN-U is also a carrier, but features are unclear (PMID: 37216690).
• PP3: SpliceAI doesn't predict any significant splicing impact (Δ scores ≤ 0.20).
• PP2: Not applicable
• PM3: Not applicable
• PM1: No code specific comments provided, please refer to the summary above or general recommendations provided in the guideline
• PM4: No code specific comments provided, please refer to the summary above or general recommendations provided in the guideline
• PM6: No relevant cases found in literature search, including LOVD, HGMD, ClinVar, COSMIC, Mastermind, and Google/Google Scholar searches.
• BA1: Completely absent from gnomAD with a mean coverage of at least 20X (v2+v3+v4).
• BS4: No relevant cases found in literature search, including LOVD, HGMD, ClinVar, COSMIC, Mastermind, and Google/Google Scholar searches.
• BS3: No relevant literature was found in LOVD, HGMD, ClinVar, COSMIC, Mastermind, and Google/Google Scholar searches.
• BS1: Completely absent from gnomAD with a mean coverage of at least 20X (v2+v3+v4).
• BS2: not applicable
• BP5: Not applicable
• BP7: No code specific comments provided, please refer to the summary above or general recommendations provided in the guideline
• BP2: No code specific comments provided, please refer to the summary above or general recommendations provided in the guideline
• BP3: Not applicable
• BP4: SpliceAI doesn't predict any significant splicing impact (Δ scores ≤ 0.20).
• BP1: Not applicable