Variant: NM_000527.5(LDLR):c.1361C>A (p.Thr454Asn)

CA10585425

251812 (ClinVar)

Gene: LDLR

Condition: hypercholesterolemia, familial

Inheritance Mode: Semidominant inheritance

UUID: bceb5fe5-d799-4bbe-9625-e9eea69def7f

Approved on: 2022-01-31

Published on: 2022-07-11

HGVS expressions

NM_000527.5:c.1361C>A
NM_000527.5(LDLR):c.1361C>A (p.Thr454Asn)
NC_000019.10:g.11113537C>A
CM000681.2:g.11113537C>A
NC_000019.9:g.11224213C>A
CM000681.1:g.11224213C>A
NC_000019.8:g.11085213C>A
NG_009060.1:g.29157C>A
ENST00000558518.6:c.1361C>A
ENST00000252444.9:n.1615C>A
ENST00000455727.6:c.857C>A
ENST00000535915.5:c.1238C>A
ENST00000545707.5:c.980C>A
ENST00000557933.5:c.1361C>A
ENST00000558013.5:c.1361C>A
ENST00000558518.5:c.1361C>A
ENST00000559340.1:n.82C>A
ENST00000560467.1:n.841C>A
NM_000527.4:c.1361C>A
NM_001195798.1:c.1361C>A
NM_001195799.1:c.1238C>A
NM_001195800.1:c.857C>A
NM_001195803.1:c.980C>A
NM_001195798.2:c.1361C>A
NM_001195799.2:c.1238C>A
NM_001195800.2:c.857C>A
NM_001195803.2:c.980C>A

Likely Pathogenic

• Met criteria codes: PS3 PM2 PP4

• Not Met criteria codes: BP2 BP3 BP4 BP1 BP5 BP7 PS2 PS4 PS1 PM3 PM1 PM4 PM5 PM6 BA1 PP1 PP3 PP2 PVS1 BS2 BS4 BS3 BS1

Expert Panel

Familial Hypercholesterolemia VCEP

Criteria Specification Information

Criteria Specification: ClinGen Familial Hypercholesterolemia Expert Panel Specifications to the ACMG/AMP Variant Classification Guidelines Version 1.1

Evidence submitted by expert panel

Familial Hypercholesterolemia VCEP

The NM_000527.5(LDLR):c.1361C>A (p.Thr454Asn) variant is classified as Likely pathogenic for Familial Hypercholesterolemia by applying evidence codes PS3, PM2 and PP4 as defined by the ClinGen Familial Hypercholesterolemia Expert Panel LDLR-specific variant curation guidelines (https://doi.org/10.1016/j.gim.2021.09.012). The supporting evidence is as follows: PS3 - Level 1 FS: Etxebarria et al. 2015 (PMID 25378237): Heterologous cells (CHO) with FACS - results: 65% LDL-LDLR binding, uptake and cell surface LDLR --- activity is below 70% of wild-type, so PS3 is met. PM2 - This variant is absent from gnomAD (gnomAD v2.1.1), so PM2 is met. PP4 - variant meets PM2 and was identified in 1 index case with MEDPED clinical criteria of FH (45 year old female with TC 398mg/dl) from PMID: 19007590 (Civeira et al. 2008), Spain; so PP4 is met.

Met criteria codes

• PS3: Level 1 FS: Etxebarria et al. 2015 (PMID 25378237): Heterologous cells (CHO) with FACS - results: 65% LDL-LDLR binding, uptake and cell surface LDLR --- activity is below 70% of wild-type, so PS3 is met
• PM2: This variant is absent from gnomAD (gnomAD v2.1.1), so PM2 is met
• PP4: variant meets PM2 and was identified in - 9 cases (but paper just states with clinical diagnosis of FH, but does not specify criteria used) from PMID 25378237 (Etxebarria et al. 2015), Spain; - 1 index case (but does not specify clearly if DLCN>6) from PMID: 15241806 (Mozas et al. 2004), Spain; - 1 index case with MEDPED clinical criteria of FH (45 year old female with TC 398mg/dl) from PMID: 19007590 (Civeira et al. 2008), Spain; --- since 1 index case clearly fulfills clinical criteria of FH, PP4 is met

Not Met criteria codes

• BP2: not identified in index cases with more than 1 variant
• BP3: not applicable
• BP4: REVEL = 0.473, it is below 0.50, splicing evaluation required. Functional data on splicing not available. A) variant located at -20 to +3 bases from canonical acceptor splice site MES scores: canonical site variant (CTTCTCTCCTCCTGCCTCAGCAA) = 6.40; canonical site wt (CTTCTCTCCTCCTGCCTCAGCAC) = 6.76. Ratio variant/wt canonical acceptor: 6.40/6.76 = 0.947 ---- It is not above 1.0 Variant is not predicted to not alter splicing, so BP4 is not met
• BP1: not applicable
• BP5: not applicable
• BP7: variant is missense, so not met
• PS2: no de novo occurrence
• PS4: variant meets PM2 and was identified in - 9 cases (but paper just states with clinical diagnosis of FH, but does not specify criteria used) from PMID 25378237 (Etxebarria et al. 2015), Spain; - 1 index case (but does not specify clearly if DLCN>6) from PMID: 15241806 (Mozas et al. 2004), Spain; - 1 index case with MEDPED clinical criteria of FH (45 year old female with TC 398mg/dl) from PMID: 19007590 (Civeira et al. 2008), Spain; --- since only 1 index case clearly fulfills clinical criteria of FH, PS4_Supporting is not met
• PS1: there are no other missense variants described in the same codon, so not met
• PM3: not identified in index cases with more than 1 variant
• PM1: variant is missense and meets PM2, but it is not in exon 4 and does not alter Cys, so not met
• PM4: variant is missense, so not met
• PM5: there are no other missense variants described in the same codon, so not met
• PM6: no de novo occurrence
• BA1: This variant is absent from gnomAD (gnomAD v2.1.1), so not met
• PP1: no segregation data
• PP3: REVEL = 0.473, it is not above 0.75, splicing evaluation required. Functional data on splicing not available. A) variant located at -20 to +3 bases from canonical acceptor splice site MES scores: canonical site variant (CTTCTCTCCTCCTGCCTCAGCAA) = 6.40; canonical site wt (CTTCTCTCCTCCTGCCTCAGCAC) = 6.76. Ratio variant/wt canonical acceptor: 6.40/6.76 = 0.947 ---- It is not below 0.8 Variant is predicted to not alter splicing, so PP3 is not met
• PP2: not applicable
• PVS1: variant is missense and not in initiation codon, so not met
• BS2: not identified in normolipidemic individuals, so not met
• BS4: no segregation data
• BS3: Level 1 FS: Etxebarria et al. 2015 (PMID 25378237): Heterologous cells (CHO) with FACS - results: 65% LDL-LDLR binding, uptake and cell surface LDLR --- activity is not above 90% of wild-type, so BS3 is not met
• BS1: This variant is absent from gnomAD (gnomAD v2.1.1), so not met